PPT-Shotgun Sequencing of Bacteria from AHPNS

A New Shrimp Disease Threat for Thailand SUMMARY The most threatening new problem in Asian shrimp aquaculture at this time is serious mortality from unknown causes that began in China in 2009 then Vietnam since 2010 and more recently in 2011 to the eastern . Shotgun Cache and mynewshotgun.com provide top-notch new and used target and sporting shotguns along with great customer service and support - a combination that can't be beat!  And to see your target more clearly let Susie outfit you with a set of Decot Sport Glasses.  The "Shooters Choice". SHOW ALL. HIDE ALL. A. B. C. D. E. F. G. H. I. Shotgun Cartridge . SHOW ALL. HIDE ALL. B. C. D. E. F. G. H. I. A . cartridge or round packages the bullet, gunpowder, and primer into a single metallic case precisely made to fit the firing chamber of a firearm.. Sanger DNA sequencing, as you may guess, only works primer (best from about 30 nt to 350 nt; the Next-generation shotgun sequencing approaches require sequencing every base in a sample several times for two reasons: Abstract. Background. Methods. To improve the mapping of metagenome-derived DNA sequence to homologous protein coding sequences in reference databases, we have developed an algorithm that maps sequence reads to a reference in the amino acid space. . Last lecture summary. recombinant DNA technology. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Dan . Russell. Overview. Prologue: Assembly and Finishing. The Past: Sanger. The Present: Next-Gen (454, . Illumina. , …). The Future: ? (. Nanopore. , . MinION. , Single-molecule). Overview. Prologue: Assembly and Finishing. Dan . Russell. The past, present, and future of DNA . sequencing*. Dan . Russell. *DNA sequencing:. D. etermining the number and order of nucleotides that make up a given molecule of DNA.. (Relevant) Trivia. Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA). DNA cloning – vector (plasmid, BAC), PCR. genome mapping. relative locations of genes are established by following inheritance patterns. Modified from Dan Russell. (Relevant) Trivia. How many base pairs (bp) are there in a human genome?. How many protein coding genes are in the Human genome. How much did it cost to sequence the first human genome?. DNA Cloning. 3. Introduction . into. host cell. Restriction Enzymes. PCR. Polymerase. Chain. Reaction. Antibiotic Selection. Antibiotics, such as penicillin and ampicillin, kill bacteria. Plasmids can carry genes that give host bacterium a resistance against antibiotics. 1 David Wishart, Ath3-41 DNA Sequencing 2 Principles of DNA Sequencing PBR322AmpTet DNA fragmentDenature withheat to producessDNAKlenow+ ddNTP+ dNTP+ primers The Secret to Sanger Sequencing 4 Capillar