Explore
Featured
Recent
Articles
Topics
Login
Upload
Featured
Recent
Articles
Topics
Login
Upload
Search Results for 'Genome'
Genome published presentations and documents on DocSlides.
Polysaccharide A
by olivia-moreira
a. widely distributed . immunoregulatory. micro...
Getting Started with IGV
by pasty-toler
Programming for Biology 2015. Madelaine Gogol. Pr...
BIO 508
by phoebe-click
Comparative Genomics. Eric Franzosa, PhD. 2 April...
Purposes and features
by lois-ondreau
Browse genes in their genomic context.. See featu...
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
ENCODE 2012
by conchita-marotz
The Human Genome project sequenced “the human g...
A high-resolution map of human evolutionary constraints usi
by trish-goza
Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...
Detecting selection using genome scans
by ellena-manuel
Roger Butlin. University of Sheffield. Nielsen R....
Viral Evolution in
by ellena-manuel
Endosymbionts. February 11, . 2012. Seth Bordenst...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph
by pamella-moone
http://galaxyproject.org/ for genome and epigenome...
The Autism Genome Project and Genocide
by danika-pritchard
The Unbearable Uncertainty of Being (Autistic). P...
Analysis of Next Generation Sequence Data
by luanne-stotts
BIOST 2055. 04/06/2015. Last Lecture . Genome-wid...
BE/APh161 – Physical Biology of the Cell
by tatiana-dople
Rob Phillips. Applied Physics and Bioengineering....
Presenting:
by karlyn-bohler
On the immortality of television sets: “functio...
Vibrio
by luanne-stotts
genome analysis. Christina. Isabella. Roland. Sa...
Last lecture summary
by briana-ranney
Sequencing strategies. Hierarchical genome shotgu...
P řednáška 13. 3. odpadá
by sherrill-nordquist
Last lecture summary. recombinant DNA technology....
How do Replication and Transcription Change Genomes?
by conchita-marotz
Andrey Grigoriev. Director, Center for Computatio...
The Pines
by tawny-fly
October 28, . 2013. Genomic Medicine. Malcolm Cam...
Denovo
by olivia-moreira
genome assembly . and analysis. outline. De novo...
Predicting Genes in Mycobacteriophages
by phoebe-click
December . 8. , 2014. 2014 In . S. ilico. Worksh...
ENCODE 2012
by test
The Human Genome project sequenced “the human g...
Practical Guide to the (mod)ENCODE project
by mitsue-stanley
February . 27 2013. Fundamental Goals. Improve co...
“An
by trish-goza
integrated encyclopedia of DNA elements in the hu...
Cells
by stefany-barnette
Are we done yet?. Answer: Almost.. What do we nee...
Virus Life Cycles in 3D
by olivia-moreira
The Art of Reconstruction. In order to survive, v...
Outline
by min-jolicoeur
Whole Genome Assembly. How it works. How to make ...
Sequencing extinct human ancestors
by kittie-lecroy
Credits to Vanessa Patel for some of the slides. ...
Improving RAST annotations within RAST
by tatiana-dople
Veronika Vonstein. Fellowship for Interpretation ...
University of Connecticut
by min-jolicoeur
School of Engineering. Assembler. Reference. Abys...
Jeri Dilts
by karlyn-bohler
Suzanna Kim. Hema Nagrajan. Deepak Purushotham. A...
Genomics and Personalized Care in Health Systems
by lois-ondreau
Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...
Sequence Comparison and
by cheryl-pisano
Genome Alignment in the Human Genome. Jian. Ma....
Fast and accurate short read alignment with Burrows–Wheel
by danika-pritchard
transform. Heng. Li and Richard Durbin∗. Membe...
The exam was written based on 100 points. Dr. Cline will w
by danika-pritchard
Important . – please keep your answers short; c...
cs3102: Theory of Computation
by marina-yarberry
Class 26: . NP-Complete Entr. é. es. (DNA with a...
Sorting by Cuts, Joins and Whole Chromosome Duplications
by alexa-scheidler
Ron Zeira. and Ron Shamir. Combinatorial Pattern...
Genomes and their evolution
by stefany-barnette
Chapter 21. You must know. How prokaryotic genome...
The impact of next-generation sequencing technology of gene
by sherrill-nordquist
Elaine R. . Mardis. – 11 . February. . 2008. W...
Load More...