CSE291 Personal Genomics for Bioinformaticians 01 1017 The personal genomics revolution 23andMe gt1 million customers 200 Genographic Project gt800000 customers 150 Family Tree DNA ID: 1044621
Download Presentation The PPT/PDF document "Introduction to your genome" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
1. Introduction to your genomeCSE291: Personal Genomics for Bioinformaticians01/10/17
2. The personal genomics revolution23andMe: >1 million customers ($200)Genographic Project: >800,000 customers ($150)Family Tree DNA: >800,000 in database ($99)Genome sequencing is quickly becoming a commodity!
3. The power of commercial genome databasesSurvey: are you a morning or a night person?Hu et al. Nature Communications 2016Survey: what color are the stripes?Can perform a GWAS on hundreds of thousands of people in a matter of days!
4. I have a long standing interest in genetics…Extra credit: which one is me?Age: 20Age: 1
5. OutlineWhy analyze your genome?Course overviewHistory of analyzing genomesBasic biology introBasic human genetics introDiscuss problem set 1
6. Why analyze your genome?
7. Mutations have implications in human healthExample: Cystic FibrosisCaused by mutations in the gene CFTR, most common mutation is Δ508.Results in salty skin, poor growth, accumulation of thick, sticky mucus, frequent chest infections.Life expectancy: 37 years~1 in 25 Europeans is a carrier0 10 11 1: 25%0 0: 25%0 1: 50%1 1Pre-natal carrier testing of parents can now identify couples at risk and inform reproductive options
8. Our genomes contain a record of human historyNovembre, et al. 2008Recent historyAncient historyFamilial relationshipsParents, siblings, cousins, etc.PopulationsHuman migration, ancient humanshttps://aliciarmartin.com/research/migration_map_revised-2/
9. Your genome is uniquely identifying
10. Your genome can help science!Interpreting one genome requires tens of thousands of genomes- Daniel MacArthurvs.e.g. latest schizophrenia genome wide association study used >100,000 control genomes!
11. Course overview
12. Course objectivesGain basic bioinformatics skills needed to analyze a personal genome using the UNIX command lineGain the ability to critically read and interpret basic science and translational literature relevant to personal genomicsDemonstrate knowledge and understanding of the social impacts of the personal genomics revolutionGain skills and experience necessary to carry out original research related to personal genomics
13.
14. GradingParticipation 10%Attendance 10%Problem set 1 5%Problem set 2 10%Problem set 3 10%Problem set 4 10%Problem set 5 10%Project proposal 5%Final Project 30%
15. Analyzing your own genomeYou are welcome and encouraged to explore your own genome (e.g. from 23andMe) through the problem sets.If you want to do that, order ASAP, it takes several weeks to get the data back.Your grade does not depend in any way on whether you analyze your own genome.You do not need to tell me if you analyze your own genome.We cannot offer to pay for the test, or provide any counseling
16. A whirlwind history of human genetics
17. Mendel establishes heredity as a principle (~1865)Green peasYellow peasF1 Generation100% YellowF2 Generation75% Yellow25% GreenConclusions:Inheritance is determined by “units” (now called genes)An individual inherits one such unit from each parent for each traitA trait my “skip” a generationGGYYYGYGYGYGYYYGGYGG
18. mid-1900s: DNA is the genetic materialGriffith experiment (1928): showed bacteria can transfer genetic informationAvery-MacLeod-McCarty experiment (1944): showed that DNA was key component of Griffith’s experimentHershey-Chase experiment (1952): used radioactive labeling to show DNA, not protein, transfers genetic informationDNA structure identified (1953) by Watson, Crick (using data from Rosalind Franklin)
19. First disease gene mapped (1983)George Huntington’s paper (1872)Huntington’s DiseaseProgressive neurodegenerative diseaseLoss of motor control, jerky movementsAge of onset: typically 30-45 years oldCaused by expansion of a CAG repeat, encoding polyglutamine, in the gene HTTGusella et al. 1983
20. The human genome is sequenced (2001)$3 Billion public project beginning in 1990In 1998, Craig Venter started competing private project at Celera“Draft” published in 2000. We still do not have a complete genome sequence!>70% from a single male donor from Buffalo, NY (RP11). At least 4 individuals included.
21. Toward the $1000 Genome
22. The personal genomics revolution>1 million customers$200 to genotype 1.5 million genomic positionsHair colorEye colorAncestry
23. Biology Intro
24. Bird’s eye view of the human genomehttp://missinglink.ucsf.edu/lm/genes_and_genomes/content.htmlCellNucleusSex chromosomesAutosomes
25. DNA (deoxyribonucleic acid) structureBases: CCytosineGGuanineAAdenineTThymineOther components:PhosphateDeoxyribose(sugar)Base pairing Watson-CrickCGATGCTA5’3’3’5’Forward strand: 5’-TGAC-3’Reverse strand: 5’-GTCA-3’ (reverse complement)
26. The central dogmaDNARNAProteinDNAGENETranscriptionmRNATranslationProtein
27. The genetic codehttp://www.chemguide.co.uk/organicprops/aminoacids/dna4.html
28. The structure of a genePromoterTFACACUAUCGAUGCAGAUAAAGUUGAGUAGCUGUCUCGGUCGAGCGUACGUAUAAAUCACUACExon 1Exon 2Exon 3Intron 1Intron 2TranscriptionDNARNAmRNA5’ UTR3’ UTRSplicingACACUAUCGAUGCAGAUAAAUAGCUGUCUCGCGUACGUAUAAATCACUACTranslationProteinMQINSCLAYV*Start codon (AUG=Methionine)Stop codon (UGA, UAA, UAG)
29. Organization of the human genomehttp://book.bionumbers.org/how-many-genes-are-in-a-genome/~30,000 protein coding genes in the human genome
30. Cell division – mitosis (somatic)DNA replicationMitosisTwo diploid cells
31. Cell division – meiosis (germline)DNA replicationHomologous recombinationFour haploid cellsMeiosis IMeiosis II
32. Recombinationhttps://www.reddit.com/r/askscience/comments/3hq4zl/does_crossover_occur_in_all_4_nonsister/
33. Human genetics intro
34. ACGACTCGAGCGACGACACGAGCGμSNP: 1.20 × 10-8 /loc/genSNPACGACTCGAGCGACGAC-CGAGCGμINDEL: 0.68 × 10-9 /loc/genShort indel (1-20bp)Short tandem repeatCAGCAG---CAGCAGCACAGCAGCAGCAGCAGCAμSTR: 10-2-10-5 /loc/genAlu retrotranspositionAluStruct. Var /CNV (>20bp)STR~75+Alu0.05SV0.2Indel3SNP50# de novo/gen0255075100Mutations – the bread and butter of genetics!STR~75+Alu0.05SV0.2Indel3SNP50# de novo/gen0255075100
35. How do mutations affect proteins?http://www.nbs.csudh.edu/chemistry/faculty/nsturm/CHEMXL153/DNAMutationRepair.htmBut also…Regulatory regionsLarge structural variationsAlternative splicingMany others…
36. Intro to Mendelian geneticsYGYYYGGYGGBack to Mendel’s peas…F2 Generation75% Yellow25% GreenParent 1Parent 2YYGxGYGYYGYYGGG
37. Modes of inheritance - dominantAaaaAaAaaaaa>=1 copies of dominant allele: affected0 copies of dominant allele: unaffectedUnless de novo, at least one parent is affectedExample – Marfan SyndromeTall and slender buildLong arms, legs, and fingersHeart murmurs, other cardiovascular defectsNearsightednessCaused by loss of function mutations in FBN1http://www.mayoclinic.org/diseases-conditions/marfan-syndrome/symptoms-causes/dxc-20195415
38. Modes of inheritance - recessiveAaAaAAAaaAaa2 copies of recessive allele: affected<=1 copies of recessive allele: unaffectedOften, both parents unaffectedExample – Cystic FibrosisCaused by mutations in the gene CFTR, most common mutation is Δ508 (in frame deletion).Results in salty skin, poor growth, accumulation of thick, sticky mucus, frequent chest infections.Life expectancy: 37 years~1 in 25 Europeans is a carrierCaused by loss of function mutations in CFTRhttps://hutchbio.wordpress.com/2012/11/07/cystic-fibrosis/
39. Modes of inheritance – X linked recessiveXYXX’X’YXYXX’XXNeed at least one unaffected copy of X to be unaffectedX’Y, X’X’ affected (X’X’ lethal for some disorders)Typically affects only malesHeterozygous females are called “carriers”Example – Hemophilia ABlood doesn’t clot properlyHeavy bleeding even from small cutsBruise easilySome female carriers show symptomsCaused by loss of function mutations in clotting Factor VIII http://reference.medscape.com/features/slideshow/hemophilia-a
40. Example recessive trait – red hairhttps://blog.23andme.com/health-traits/no-im-not-irish/
41. Example recessive trait – blue eyesWalsh, et al. 2010Sturm, et al. 2008IrisPlex: predicts eye color from 6 SNPsAll blue eyes have a single common ancestor with a regulatory change in HERC2
42. Beyond Mendelian – complex traitsExample: heightSir Ronald FisherFisher hypothesized that Mendelian traits could explain continuous traits if many genes each contribute additively to a phenotype.
43. Example complex trait: schizophreniaSchizophrenia Working Group of the Psychiatric Genomics ConsortiumHeritability: 80%i.e. 80% of twin pairs concordant for SCZ status
44. Problem set 1
45. SNP array dataThis is the type of data you’ll get from 23andMe and other companiesAs opposed to whole genome sequencing, which sequences the entire genome, genotype arrays genotyped a pre-determined set of known polymorphic positionsE.g. 23andMe genotypes ~1.5 million variantsAAABBBProbes for allele “A” and “B”By comparing intensities, can infer genotype (e.g. AA, AB, BB)
46. Getting startedhttps://gymreklab.github.io/teaching/personal_genomics/ps1_resources.htmlSign up for an XSEDE accountGet started on PS1Before you go: