Search Results for 'Germline-Cell'

Germline-Cell published presentations and documents on DocSlides.

Breakout session 1 Somatic-to-germline
Breakout session 1 Somatic-to-germline
by unita
testing . pathways. Format. Round table discussion...
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards
by lois-ondreau
Ben Ho Park MD PhD. Johns Hopkins University. Fin...
Why and how to test for germline
Why and how to test for germline
by isabella2
BRCA. mutations in Pancreatic Cancer. ESDO Learni...
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
European Medicines Agency 7 Westferry Circus Canary Wharf London E1
by bery
ICH Considerations General Principles to Address...
UTSW Cancer Genetics
UTSW Cancer Genetics
by taylor
CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...
IntroductionKnowledge of spatial and temporal gene expression proles
IntroductionKnowledge of spatial and temporal gene expression proles
by delilah
We performed a genome-wide analysis of gene expres...
Genetic testing in ovarian cancer
Genetic testing in ovarian cancer
by BlueEyedBeauty
Dr Katie Snape. Joint Lead Consultant for Cancer G...
Governance, Regulation, and Control:
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
National Childhood Cancer Registry
National Childhood Cancer Registry
by walter434
Long Term Outcomes of Children and Young Adults wi...
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing
by edolie
State University of Campinas (UNICAMP). School of ...
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant
by ava
WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FA...
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals
by mary
Presented by: . Amit Levi. Class of 2022. Mentor:....
Readiness   level   of
Readiness level of
by finley
the. . Brazilian. . regulatory. framework: . ca...
Clinical interpretation of genomic variants
Clinical interpretation of genomic variants
by trinity
Harriet Feilotter, PhD, FCCMG, FACMG. Professor, D...
“Mainstream” Genetic Consultation
“Mainstream” Genetic Consultation
by ida
Patient meets eligibility criteria as per . Nation...
Clare Turnbull,  PhD FRCP
Clare Turnbull, PhD FRCP
by ash
FRCPath. MFPH MSc (Epidemiology). Professor in Tr...
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,
by ethlyn
South West Genomic Laboratory Hub. 23. rd. Februa...
Prudence in  Germline  Gene Editing
Prudence in Germline Gene Editing
by rose
The Urgent Need for Collaborative Partnerships in ...
Genomic Prostate Cancer Testing for Olaparib
Genomic Prostate Cancer Testing for Olaparib
by abigail
Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...
proteins that can be engineered to induce a doublestrand break in a s
proteins that can be engineered to induce a doublestrand break in a s
by obrien
in animals such as rats the precise effects of gen...
Hereditary syndromes, genetic testing and
Hereditary syndromes, genetic testing and
by Kingslayer
gynaecological. cancers. Prof.. Nicoletta . Col...
Clinical Benefit of Integrative Genomic Profiling
Clinical Benefit of Integrative Genomic Profiling
by ava
in Advanced Solid Tumors. EDRN Biomarker Developme...
Human genome editing: ethics, engagement and governance
Human genome editing: ethics, engagement and governance
by ella
12 – 13 November 2019, Singapore. www.gfbr.globa...
Human germline modification
Human germline modification
by brianna
Fatal genetic . d. isorders . No cure. 1 in 3 inf...
molecular
molecular
by miller
HEVA screen is a kit for the analysis of the ATM, ...
MIWI and MILI find small partnersTwo independent reports reveal the ex
MIWI and MILI find small partnersTwo independent reports reveal the ex
by jones
DOI:10.1038/nrg1908URLs RNA WORLD ORIGINAL RESEARC...
Please note, these are the actual video-recorded
Please note, these are the actual video-recorded
by blindnessinfluenced
proceedings from the live CME event and may includ...
 Patient Selection for PARP
Patient Selection for PARP
by sherrill-nordquist
Inhibitors:. Purpose and Practicalities . Present...
Editorial governance in
Editorial governance in
by mitsue-stanley
germline. gene editing. Philip Campbell. Editor-...
Case Discussion: Second
Case Discussion: Second
by celsa-spraggs
Opinion. 55 year-old woman with . recurrent . ova...
ASHG  Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud
by tatyana-admore
Karchin Lab. Department of Biomedical Engineering...
State of the Art in  BRCA
State of the Art in BRCA
by ellena-manuel
-Mutated Ovarian Cancer. This program will includ...
Nathan Krohne
Nathan Krohne
by lois-ondreau
Color Blindness. Discovery. John Dalton, an Engli...
tcacctcctgtagggcatct
tcacctcctgtagggcatct
by tawny-fly
▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...
U nknown genetic predisposition
U nknown genetic predisposition
by tatyana-admore
in familial breast cancer . . can . lie deep in ...
U nknown genetic predisposition
U nknown genetic predisposition
by lois-ondreau
in familial breast cancer . . can . lie deep in ...