Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Sequences-Terms'

Sequences-Terms published presentations and documents on DocSlides.

Ultra
Ultra
by briana-ranney
-large . Multiple Sequence Alignment. Tandy Warno...
Phylogenomics Symposium
Phylogenomics Symposium
by conchita-marotz
and Software School. Tandy Warnow. Departments of...
Constraint Mining of Frequent Patterns in Long Sequences
Constraint Mining of Frequent Patterns in Long Sequences
by stefany-barnette
Presented by . Yaron. . Gonen. Outline. Introduc...
Last lecture summary
Last lecture summary
by briana-ranney
Sequencing strategies. Hierarchical genome shotgu...
MCB 5472
MCB 5472
by conchita-marotz
Blast, Psi BLAST, . Perl: Arrays, Loops . J. Pete...
Previous Lecture:
Previous Lecture:
by liane-varnes
Probability. Introduction to Biostatistics and Bi...
The Superdiversifier:
The Superdiversifier:
by marina-yarberry
Peephole Individualization for Software Protectio...
Ph ylogenetic analysis
Ph ylogenetic analysis
by faustina-dinatale
Phylogenetics. Phylogenetics. is the study of th...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Overlap of the human CD8
Overlap of the human CD8
by ellena-manuel
+. T cell receptor repertoire. Harlan S. . Robin...
Last lecture summary
Last lecture summary
by yoshiko-marsland
identity vs. similarity. homology vs. similarity....
TURE REVIEWS GENETICSVOLUME 5 MAY 2004
TURE REVIEWS GENETICSVOLUME 5 MAY 2004
by luanne-stotts
OUTGROUP SEQUENCES phylogenetics,sequences thatare...
N=50 s=0.1
N=50 s=0.1
by stefany-barnette
50 replicates. s>0. Time till fixation on aver...
Random Genetic Drift
Random Genetic Drift
by briana-ranney
Selection. Allele frequency. 0. 100. advantageous...
Amino Acid Sequence Analysis of Cytochrome C in Bacteria an
Amino Acid Sequence Analysis of Cytochrome C in Bacteria an
by jane-oiler
We live in a human-centric world.. Life exists ou...
1 Introduction to Sequence Analysis
1 Introduction to Sequence Analysis
by stefany-barnette
Utah State University – Spring . 2012. STAT 557...
Add+Vantage
Add+Vantage
by alexa-scheidler
Math. Woodland Park School District. Why . Add+V...
BIO 508
BIO 508
by phoebe-click
Comparative Genomics. Eric Franzosa, PhD. 2 April...
Multiple Sequence Alignments
Multiple Sequence Alignments
by min-jolicoeur
and Sequence Profiles. Multiple sequence alignmen...
Web Databases for
Web Databases for
by pamella-moone
Drosophila. An introduction to web tools, databas...
Recurrent-Neural-Networks-Mastering-Sequences-in
Recurrent-Neural-Networks-Mastering-Sequences-in
by wila
This presentation introduces Recurrent Neural Netw...
Figure 2 Figure 2. Phylogenetic tree illustrating the genetic relationship of hemorrhagic
Figure 2 Figure 2. Phylogenetic tree illustrating the genetic relationship of hemorrhagic
by reese
Ternovoi VA, Kurzhukov GP, Sokolov YV, Ivanov GY, ...
Figure 3 Figure 3. Phylogenetic tree of viral protein (VP) 1 gene sequences showing the re
Figure 3 Figure 3. Phylogenetic tree of viral protein (VP) 1 gene sequences showing the re
by julia
Markey PG, Davis JS, Harnett GB, Williams SH, Spee...
Figure 2 Figure 2. Phylogenetic relationships among Tacaribe serocomplex viruses from the
Figure 2 Figure 2. Phylogenetic relationships among Tacaribe serocomplex viruses from the
by ashley
Cajimat M, Milazzo M, Bradley RD, Fulhorst CF. Oco...
CS 581 Tandy Warnow Topics
CS 581 Tandy Warnow Topics
by harper
Introducing maximum parsimony. Maximum parsimony i...
Figure Figure. Phylogenetic analysis of sequences coding for the carboxyl terminal end (450 nt) of
Figure Figure. Phylogenetic analysis of sequences coding for the carboxyl terminal end (450 nt) of
by madeline
Kuttiatt VS, Kalpathodi S, Gangadharan ST, Kailas ...
Figure 2 Figure 2. Phylogenetic tree of the 167 Klebsiella pneumoniae genomes as determined on the
Figure 2 Figure 2. Phylogenetic tree of the 167 Klebsiella pneumoniae genomes as determined on the
by elise
Bialek-Davenet S, Criscuolo A, Ailloud F, Passet V...
Topic – Enzymes Presented
Topic – Enzymes Presented
by berey
by. Prof. . Meena. . Nagawanshi. Professor . Depa...
Characterization of Resveratrol Binding Sites in ATP Synthase
Characterization of Resveratrol Binding Sites in ATP Synthase
by felicity
Through . Molecular Analysis of Candidate Subunits...
N ext g eneration and E
N ext g eneration and E
by emmy
xtended sequencing . W. orking . group (. NEW. ) f...
1 1 Genes and Proteins
1 1 Genes and Proteins
by jade
Katerina . Dadakova. , Department . of. . Biochem...
DNA profiling of sweetpotato
DNA profiling of sweetpotato
by murphy
cultivars and clones. GT4SP Capacity building &...
Immunoglobulins and
Immunoglobulins and
by sophia2
Immunoglobulin Genes. immunoglobulins. The two hal...
V7 – Genomics data Program for today:
V7 – Genomics data Program for today:
by carny
SNP . frequencies in 1000 Genomes . data. Repeats ...
Genome Sciences 373 Genome Informatics
Genome Sciences 373 Genome Informatics
by walsh
Q. uiz Section . 5. April . 28, . 2015. Bonferroni...
Restriction Enzymes Restriction Modification System
Restriction Enzymes Restriction Modification System
by emily
Cutting DNA molecules. . B...
Supplementary Figure 1 Conserved amino acid sequences of
Supplementary Figure 1 Conserved amino acid sequences of
by pagi
PsaM. proteins. Blue mark indicate conservation o...
Genes, regulatory and non-coding single copy sequences
Genes, regulatory and non-coding single copy sequences
by fanny
Dispersed repeats:. Transposable Elements. Repetit...
1 An Introduction to Bioinformatics
1 An Introduction to Bioinformatics
by bery
and its application in . Protein-DNA/Protein  Int...
Bioinformatics analysis
Bioinformatics analysis
by oconnor
pipeline . for. viral . metagenomics. 16-12-05. Da...