PPT-Whole-genome
Author : briana-ranney | Published Date : 2017-05-18
resequencing of circa 1000 lines was accomplished including world reference genotype Tift 23D 2 B 1 P1P5 association mapping panel PMiGAP wild species from West
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "Whole-genome" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Whole-genome: Transcript
resequencing of circa 1000 lines was accomplished including world reference genotype Tift 23D 2 B 1 P1P5 association mapping panel PMiGAP wild species from West and Central Africa WCA and hybrid parental lines from SAUs and . Simply check package labels for our Whole Grain Stamp shown here It guarantees youre getting half a serving 8g or more of whole grain Every Stamp tells you just how much And if you see the 100 banner on the Stamp you know that all the grain is whole ascdorg 341269341 341 341 341 341341341269341341341 341341341341341341341341341341341 341341341341341341341341341341341341276341341341341341 341341341341341341341341341341341341341341 341341341341341341341341341341341341341341341341341341341 3413 Simply check package labels for our Whole Grain Stamp shown here It guarantees youre getting half a serving 8g or more of whole grain Every Stamp tells you just how much And if you see the 100 banner on the Stamp you know that all the grain is whole What is Whole Disk Encr yp tion Whole Disk Encr yp tion versus File Encr yp tion Jeroen. . Raes. , Jan O . Korbel. , Martin J . Lercher. , Christian von . Mering. and Peer Bork. Presented by Daehwan Kim. Outline. Genome size. Genome sizes of Archaea, Bacteria, and Eukaryotes. Factors affecting genome and genome sizes . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . The Plot. Deepak . Purushotham. Hamid Reza . Hassanzadeh. Haozheng. . Tian. Juliette . Zerick. Lavanya. . Rishishwar. Piyush. . Ranjan. Lu Wang. The Outline. The Need & The Requirement. The Options. By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. Whole Genome Sequencing for Epidemiologists – A Brief Introduction Joel R Sevinsky , PhD Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing (WGS) for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It G-OnRamp Beta Users Workshop. Wilson Leung. 07/2016. Outline. Obtain genome assemblies from NCBI. Transfer . large genomics datasets to Galaxy. Common bioinformatics file formats . D. atatypes in Galaxy. Sarah . Talarico, . PhD, MPH. Surveillance, Epidemiology, and Outbreak Investigation Branch. a. nd Laboratory Branch. California Tuberculosis Controllers Association Conference. March 12, 2019. Division of Tuberculosis Elimination. Fahad Alqahtani and Ion Mandoiu. University of Connecticut. Computer Science and Engineering Department. Outline. Introduction & prior . w. ork. Our approach. Preliminary results. Conclusion and future work.
Download Document
Here is the link to download the presentation.
"Whole-genome"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents