Making the journey from conventional genotyping to whole-genome sequencing for investigating - PowerPoint Presentation

1. Making the journey from conventional genotyping to whole-genome sequencing for investigating TB transmissionSarah Talarico, PhD, MPHSurveillance, Epidemiology, and Outbreak Investigation Branchand Laboratory BranchCalifornia Tuberculosis Controllers Association ConferenceMarch 12, 2019Division of Tuberculosis Elimination

2. Conflict of InterestNone to declare2

3. Learning objectivesAt the end of this presentation, participants will be able to describeKey differences between conventional genotyping and WGSWhat is being represented on a phylogenetic treeHow WGS is used to assess whether patients are potentially linked by recent transmissionPlans for the transition to using WGS as the standard method for TB genotyping3

4. Why combine genotypic data with clinical and epidemiologic data to understand TB transmission?Challenges to relying exclusively on epidemiologic investigationAirborne transmissionExposure in congregate settingsLong infectious periodsPatient recall may be incomplete or unreliableOften in impoverished or marginalized communitiesGenotypic data can provide additional, complementary information to aid detection and investigation of transmissionGenotyping identifies cases with genetically similar M. tuberculosis isolates that are more likely to be linked by transmission4

5. Genotyping examines the DNA of M. tuberculosis isolates from TB patientsThe M. tuberculosis bacteria from a TB patient is called the patient’s isolateBacteria, including M. tuberculosis, have DNA called a genomeDNA is made up of four different nucleotides (abbreviated A, T, C, and G)The order of these nucleotides in the genome is the DNA sequenceThe genome of M. tuberculosis is over 4.4 million nucleotides long5

6. Genotyping can be used to identify TB patients who are more likely to be linked by recent transmissionChanges in the DNA (mutations) occur over time, so M. tuberculosis bacteria don’t all have the exact same DNA sequenceAt the time of transmission, the person transmitting the infection and the person acquiring the infection will have M. tuberculosis with identical DNA sequenceGenotyping analyzes DNA to identify TB patients with similar M. tuberculosis genomes who are more likely to be linked by recent transmission6

7. Detecting Clusters of Recent Transmission using Genotyping2 or more isolates with the same genotype are clusteredAlgorithms that consider time and space are used to identify clustered cases that may be due to recent transmissionCDC cluster detection methodsLLR cluster alerts: Unexpected increase in concentration of a genotype in a jurisdiction during a 3-year time periodLarge outbreak surveillance: 10 or more cases in a 3-year period related by recent transmission7

8. Conventional M. tuberculosis genotyping is based on only ~1% of the genome8

9. Conventional genotyping vs. Whole-genome sequencing (WGS)

10. Coverage of the genomeAdapted from: Guthrie JL, Gardy JL. Ann N Y Acad Sci. 2016 Dec 23. doi: 10.1111/nyas.132731% coverage90% coverageConventional genotypingWGS10

11. Types of genomic changes analyzedConventional genotypingWGSGain or loss of segments of DNA sequence within certain repetitive regionsSingle nucleotide polymorphisms (SNPs) throughout the genomeA T G G C G T C A C G G T C A GA T G G C G T T A C G G T C A GExample: change between 3 and 2 repeat segmentsExample: mutation that changes C to T in DNA sequenceATGGCGTACGATGGCGTACGATGGCGTACGATGGCGTACGATGGCGTACG11

12. Whole-genome SNP analysis (wgSNP)A T G G C G T C A C G G T C A GA T G G C G T T A C G G T C A GSNPs that differ between isolates in a cluster are identifiedSNPs are mapped on to a phylogenetic tree to diagram the genetic relationship among isolates12

13. ResultsConventional genotypingGENTypeIsolates are clustered based on matching GENTypeCluster of isolates with GENType XWGSPhylogenetic treeIsolates in a cluster may be further distinguishedPhylogenetic tree of isolates in GENType X cluster13

14. WGS analysis: interpretation of the phylogenetic tree

15. Guide for interpreting the phylogenetic tree Isolates are shown as circles (called nodes)Isolates with the same genome type are displayed together in one nodeLines are proportional in length to the number of SNPs that differ between the isolatesLines are labeled with the number of SNPs15

16. Guide for interpreting the phylogenetic tree MRCA = Most Recent Common AncestorHypothetical genome type (not an actual isolate)All isolates on the tree are descended from this hypothetical genome typeServes as a reference point for examining the direction of genetic change( )16

17. Guide for interpreting the phylogenetic tree Closely related isolates that may be involved in recent transmissionIn general, isolates within 5 SNPs are considered closely relatedgenetically distant isolates that are unlikely to be involved in recent transmissionIn general, isolates that differ by 6 or more SNPs are considered genetically distant=17

18. Limitations of WGS analysis for understanding TB transmissionRecent transmission is easier to rule out than to confirm with WGSEven isolates that are closely related or identical by WGS can be due to reactivationThis is because mutations may not occur as frequently during latent infection and therefore SNPs may not accumulateA phylogenetic tree shows how isolates are genetically related to each other, but is not the same as a transmission diagramWGS alone should not be used to infer direction of TB transmissionImportant to consider if isolates may be missing from the analysisExamples: Cases that are not yet diagnosed, not culture-confirmed, out-of-country, or have contaminated isolates The phylogenetic tree should be used in conjunction with clinical and epidemiologic information to assess recent transmission and infer direction of TB transmission18

19. Integration and visualization of WGS, clinical, and epidemiologic data?123LITT algorithmSurveillance dataEpi investigation dataWGS dataLITT algorithm (Logically Inferred Tuberculosis Transmission)Automated integration of WGS, clinical, and epi data to identify and rank potential source casesMicrobeTrace data visualization platformDeveloped by Division of HIV/AIDS PreventionVisualization of WGS, clinical ,and epi data togetherEpi and transmission networks, timelines, phylogenetic trees, and maps(http://bit.ly/microbetrace) 19

20. Transition to universal prospective WGS

21. Retrospective WGS of GENType clusters in the United States2012: first WGS of a GENType cluster2014: WGS performed for all large outbreak alerts2016: WGS expanded to include other select GENType clusters that could inform public healthWGS and phylogenetic analysis of >200 clusters nationally to dateD.C.Number of isolates with whole-genome sequencing data*0>0 to 10 >10 to 20 >20 Puerto RicoGuamU.S. Virgin IslandsMarshall IslandsFed. States of MicronesiaAmerican SamoaN. Mariana IslandsRepublic of Palau*N = 3,700 isolates, data current as of Aug. 201821

22. Transition to universal prospective WGSWGS of isolates from all new culture-confirmed cases of TB began in March 2018GENType will continue to be analyzed during an initial 3 year transition period (2018 – 2020)GENType will be reported in TB GIMSCluster alerts will be based on GENTypeStill have some capacity to sequence isolates retrospectivelyIsolates before March 2018: Retrospective WGS by requestIsolates after March 2018: Prospective WGS for all isolates22

23. Transition to universal prospective WGSIn 2021, WGS will become the standard method for TB genotypingwgMLST will replace GENType for defining TB clusterswgMLST = whole-genome multi-locus sequence typingwgMLST is a new genotyping scheme that uses WGS dataConventional genotypingwgMLST 24 Loci MIRU + Spoligotype> 3,000 Loci GENTypewgMLSType23

24. Transition to universal prospective WGSStep 1. Define a clusterStep 2. Examine genetic relationship among isolates in the clusterCurrently: GENType (conventional genotyping)Starting 2021: wgMLSType (WGS data)wgSNP analysis24

25. Analysis of clustering using WGS data: wgMLST vs. wgSNP wgMLST(whole-genome multi-locus sequence typing)wgSNP(whole-genome single nucleotide polymorphism)Level of analysisall isolatesisolates in a clusterUseassigning isolates to a wgMLSType that can be used for cluster alertingexamining genetic relationships among isolates in a cluster OutputwgMLSType(short string of numbers similar to a GENType)phylogenetic tree25

26. Universal prospective WGS began in 2018TB Genotyping Methods and Data Flow (2018 – 2020) 26

27. wgMLSType will replace GENType for cluster alerting in 2021TB Genotyping Methods and Data Flow (2021) 27

28. SummaryWGS can provide greater resolution than conventional genotyping for investigating recent TB transmissionWhole-genome SNP analysis is performed to produce a phylogenetic tree for examining genetic relationships between isolates in a genotype clusterThe phylogenetic tree should be interpreted in the context of epidemiologic and clinical data Methods for integrating and visualizing WGS, epidemiologic, and clinical data to aid cluster investigations are being developedWe are transitioning to using WGS as the standard method for TB genotyping28

29. AcknowledgementsDTBE Applied Research TeamJamie PoseyLauren Cowan DTBE Molecular Epi ActivityBen SilkKala Marks RazClint McDanielKathryn WingleeAssociation of Public Health LaboratoriesMichigan State Public Health Laboratory29

30.