PPT-Making the journey from conventional genotyping to whole-genome sequencing for investigating

Author : osullivan | Published Date : 2024-02-09

Sarah Talarico PhD MPH Surveillance Epidemiology and Outbreak Investigation Branch a nd Laboratory Branch California Tuberculosis Controllers Association Conference

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "Making the journey from conventional gen..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Making the journey from conventional genotyping to whole-genome sequencing for investigating: Transcript


Sarah Talarico PhD MPH Surveillance Epidemiology and Outbreak Investigation Branch a nd Laboratory Branch California Tuberculosis Controllers Association Conference March 12 2019 Division of Tuberculosis Elimination. Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . Mayo/UIUC Summer . C. ourse in Computational Biology. Session Outline. Genome sequencing. Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing . From Swab to Publication. Madison I. Dunitz. 1. , David A. Coil. 1. , Jenna M. Lang. 1. , Guillaume Jospin. 1. , Aaron E. Darling. 2. , Jonathan A. Eisen. 1. UC Davis Genome Center. 1. University of California, Davis; . Method to sequence longer regions. cut many times at random (. Shotgun. ). genomic segment. Get one or two reads from each segment. ~500 bp. ~500 bp. Reconstructing the Sequence . (Fragment Assembly). Venter et. al (2004). Presented by. Ken . Vittayarukskul. Steven S. White.. Context of the Problem . Evolutionary history is directly tied to microbial genetics. Little is known. Until recently, microbial diversity was measured by PCR amplification and sequencing of only ribosomal genes. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention. Division of Tuberculosis Elimination. Objectives. At . the end of the . presentation, participants . will be . able . to . Explain the basics of tuberculosis . for Colorectal . Cancer. Ulrike (. Riki. ) Peters. Fred Hutchinson Cancer Research Center. University of Washington. Overview. Significance and rationale. . Current efforts on rare and less frequent variants. (very) large datasets. 5/24/18. Goals for the course. Understand how next-generation sequencing technologies are used in biomedical research. Learn how to use publicly available databases/websites to find specific information about genes. Whole Genome Sequencing for Epidemiologists – A Brief Introduction Joel R Sevinsky , PhD Microbial genomes Common isolate identification techniques using molecular biology Whole genome sequencing (WGS) How we obtain the sequence of nucleotides of a species. …ACGTGACTGAGGACCGTG. CGACTGAGACTGACTGGGT. CTAGCTAGACTACGTTTTA. TATATATATACGTCGTCGT. ACTGATGACTAGATTACAG. ACTGATTTAGATACCTGAC. TGATTTTAAAAAAATATT…. Tim Graubert, MD. Division of Oncology, Stem Cell Biology Section. Washington University School of Medicine. Siteman Cancer Center. Genome Center at Washington University. Genome Center Leadership. Rick Wilson. Whole genome sequencing of babies REASONS FOR USING WHOLE GENOME SEQUENCING IN BABIES There are a number of possible reasons for carrying out whole genome or exome sequencing Seeking a diagnosis for a for a rare disease Information for patients and family members Genomic Medicine Service What is your genome? Your genome is the information needed to build the human body and keep it healthy. It

Download Document

Here is the link to download the presentation.
"Making the journey from conventional genotyping to whole-genome sequencing for investigating"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.

Related Documents